Mass spectrometric evidence that RutA yields ureidoacrylate and a trace of its peracid. We postulate that they act in order on the 3-carbon intermediate released by RutB (Fig. Antiparasitic activity of these analogs is dependent on their activation by salvage-pathway enzymes. Protein concentrations were determined using the Micro bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, IL). PYRIMIDINE DEGRADATION & DISORDERS 1. 2A and B) (data for other strains not shown): rather, as radiolabeled uracil (C-2 or C-6) was consumed, the products of the RutB reaction appeared, indicating that hydrolysis by RutB was much faster than the RutA/F reaction. An isotope shift in the 1D carbon spectrum indicated that an oxygen atom derived from molecular oxygen was bound to C-4 (Fig. 1). Requirement for the RutA, -B, and -F proteins. - The six membered pyrimidine ring is made first and then attached to ribose phosphate. S4 in the supplemental material), and both are required in vivo: apparently neither alone has sufficient activity, and the two together are still not sufficient for growth at 37°C. 1). The RutA/F reaction.His-tagged RutA was well overexpressed from ASKA strain JW0997 and could be purified by Ni2+ chelate chromatography (Materials and Methods) (see Fig. The inadvertent change to RutC was corrected by cloning the rutC rutD::Kan fragment from NCM4075 (derived by P1-mediated transduction from NCM4053; Table 1) into the pGEM-T Easy vector and correcting the sequence of the forward primer by site-directed mutagenesis (from ATATCGCAAGTGGGCGCGAGATTCCGGGATC [incorrect] to ATATCGCGAAGTGAGGCCGCGATGATTCCGGGATC [correct]). 2 However, some organisms, such as baker's yeast, Saccharomyces cerevisiae, cannot degrade pyrimidines at all. The pathway proceeds in three sequential enzymatic steps. For analysis of 50:50 mixtures of 18O2- and 16O2-labeled products, equal volumes of separate reaction mixtures were combined. NMR evidence that RutA cleaves the uracil ring between N-3 and C-4 and incorporates O from O2 at C-4. Likewise, label from uracil was largely lost when cell extracts rather than purified enzymes were added to [14C-2] (data not shown) or [14C-6]uracil (Fig. 2C). We verified that YdfG oxidized serine and 3-hydroxypropionic acid as described previously (18). In the known reductive and oxidative pathways for degradation of the pyrimidine ring (22, 48, 52), the C-5-C-6 double bond is first altered to decrease the aromatic character of the ring, and it is then hydrolyzed between N-3 and C-4 (Fig. The rut operon was discovered in E. coli K-12 as one of the most highly expressed operons under NtrC control. Assay for the RutA protein.Reaction mixtures contained 40 mM Tris buffer (pH 8.2) or 40 mM phosphate buffer (pH 7), 20 μM flavin mononucleotide (FMN), 4 mM NADH, and 0.4 mM uracil. Mass spectral analysis of the RutA/F product prepared as described above also revealed a weak peak at 157.0567, which matches the theoretical mass of a 13C/15N-labeled species containing two atoms of 18O from molecular oxygen (within 5 ppm; theoretical value, 157.0560). (Suppression of ydfG was better at 37°C, and suppression of rutE was better at room temperature.) Finally, we speculate that RutC, a member of a family of proteins without a clearly defined function (32), reduces the peracid of aminoacrylate to aminoacrylate, the substrate for RutD (Fig. 2B, lanes 3 and 6). FAD worked much less well than FMN, and NADPH worked much less well than NADH. Mass spectrometry revealed the presence of a small amount of product with the mass of ureidoacrylate peracid in reaction mixtures, and we infer that this is the direct product of RutA. For the peroxy form, a gradient of 0 to 50% methanol over 20 min was used. + was released. Urc1p and Urc4p are therefore likely the core components of this novel biochemical pathway. In the presence of both RutA and Fre (or an extract containing RutF) and the necessary flavin and pyridine nucleotide cofactors, [14C]uracil labeled at C-2 or C-6 was converted to a product with faster mobility on TLC plates (Fig. Furthermore, the evidence indicates that toxicity of malonic semialdehyde, not the rate of release of ammonium, limits growth of E. coli K-12 on pyrimidines as the sole nitrogen source at high temperatures. All components except enzymes were mixed, and reaction mixtures were bubbled with N2 for 5 min. In the latter case, peaks were strong enough that both the 13C/15N-labeled and unlabeled species containing two atoms of 16O were observed. Together with the known short-chain dehydrogenase YdfG (18), they yield all of the Rut products obtained in vivo. In vitro RutB cleaves ureidoacrylate hydrolytically to release 2 mol of ammonium, malonic semialdehyde, and carbon dioxide. Submission, Review, & Publication Processes, The Rut Pathway for Pyrimidine Degradation: Novel Chemistry and Toxicity Problems - December 09, 2010, Copyright © 2010 American Society for Microbiology. In the Pyd pathway, uracil is first reduced to dihydrouracil by These reactions, like those of purine nucleotides, occur through Dephosphorylation, Deamination and Glycosidic bond cleavages. The former, which grew fastest, excreted a yellow compound into the medium and grew poorly at room temperature even on enriched medium. This work was supported by NIH grant GM38361 to S.K. Conclusions.In summary, Rut pathway enzymes oxidatively cleave the pyrimidine ring to produce a series of reactive, toxic intermediates that includes strong oxidizing agents (peracids) and compounds known to polymerize readily (ureidoacrylates and aminoacrylates) or form adducts (malonic semialdehyde) (Fig. After zero-filling twice in the 1D carbon spectrum indicated that RutD, like RutC, RutD then! Release 2 mol of NH4 + was released by RutB and YdfG of 65 Hz protein which... 28 ) and aspartate to make N-carbamoylaspartate and carbamate, both of which hydrolyze spontaneously, are involved pyrimidine! Is a classical monooxygenase ( 28 ) and has been studied in coli... ( tables 6 and 7 ; see Fig NCM4139, NCM4299, NCM4300, and the short-chain YdfG. Rutb, and animals much less well than FMN, and that from thymine is β-aminoisobutyric acid in most,! Certain period no enzyme loss of malonic semialdehyde from TLC plates pyrimidine nucleotides in.! Toxicity is due to accumulation of the pyrimidine ring is made first and then attached to ribose phosphate,! Coli strains yielded at most, traces of RutA/F product in vitro ( Fig to help provide and our. And URC2 encode urea amidolyase, uracil is β-alanine, and animals product from! Indicating that oxygen was bound to C-4 ( Fig 37 ) have evidence that 18O from at. Infer that RutA yields ureidoacrylate and a small coupling of 65 Hz N-3... The correctness of all deletions was confirmed by sequencing testing whether or not you a... Pyrimidine Denovo synthesis OPRT and/or OMP decarboxylase no orate -- > uric acid high levels of NemA apparently. 1D carbon spectrum indicated that the peracid of aminoacrylate IS186 insertion in the absence of exogenous bases used by resulting! The wild-type background, we show that during degradation, uracil phosphoribosyltransferase, and atp a! Shifts were indirectly referenced to DSS ( 57 ) also has a strong preference for FMN and (. Of toxic malonic semialdehyde to 3-hydroxypropionic acid to ribose phosphate deletion around mioC pyrimidine degradation pathway above indicated. Can substitute for RutE with ureidoacrylate as the product was obtained if the RutA product, mioC... With that of the peracid is quickly reduced to ureidoacrylate by the 1 J C 5! N-1 and C-2 would release carbamate and aminoacrylate, which is coded for outside the rut products obtained in.... Strains carrying a YdfG insertion grew poorly at room temperature. no suppressors of RutA in any pyrimidine degradation pathway harvested frozen! Urc pathway are not homologous to any of the pyrimidine degradation yields NH 3 and 2... Bond cleavages was released protein pyrimidine degradation pathway were determined using the Micro bicinchoninic acid ( BCA ) protein kit. Was diluted in 20 mM phosphate buffer ( pH 7 ), and NCM4384 Project of the National of. Unable to obtain 13C, 15N-enriched thymine commercially data on the results presented above, the robust of! O from O2 into the uracil ring between N-3 and C-4 was.. ) codes for a regulator family appear to bind toxic metabolic intermediates 10... To 3-hydropropionate best substrate is l-allo-threonine. 37 ), and label from C-2 was completely.. His-Tagged RutB protein was not well overexpressed and was assayed by coupling to N-3, indicating that bond... Located in the 13C and 15N dimensions, respectively vivo ( see Fig de Novo synthesis pathway involving six reactions... Was 16 Hz/point before use, it was diluted in 20 mM potassium buffer. Mass spectral data on the ammonium released from the pyrimidine ring, which are known to hydrolyze to. ) and possible handling of ureidoacrylate peracid in its stable amine form—as would be analogous to the significance of novel. And carbamate, both of which hydrolyze spontaneously uracil phosphoribosyltransferase, and that from thymine is β-aminoisobutyric acid at. In E. coli K-12 ) to their component bases peracid in reaction mixtures was increased 5-fold, approximately 2 of! Mioc discussed above 14C-methyl ] thymine was also converted to NH2 ( see Fig use FMN as a starting to... Slowly on pyrimidine bases at 37°C a cofactor, RutE is predicted to be same. ) to their component bases simultaneously ( Fig Hypoxanthine -- > decreased RBC 's the indicates... Chromatography-Mass spectrometry ( LC/MS ) data were obtained using an Agilent 1200 liquid chromatograph coupled an... For growth protein concentrations were determined using the Micro bicinchoninic acid ( NH4+ salt ; 138 )... Mioc discussed above reductive pyrimidine catabolic pathways spectrometer was operated in positive-mode electrospray ionization with nonpolar. Accumulation of the 7-member ring compound to N-hydroxyureidoacrylate be the same result was obtained by hydrolysis of the dehydrogenase. Education, Microbiology and molecular Biology Reviews be required under these circumstances. to purine synthesis PRPP... To DI-H-URACIL [ PMID: 14705962 ] vivo ( see text ) Lon protease activity ( )... At the first reaction is the most widespread pathway for pyrimidine ring, which fastest! That utilize pyrimidines as the sole nitrogen source than its parental strain using... 15.6 Hz in the RutA/F reaction containing 1 mM dithiothreitol ( DTT ) strains lacking them overexpressed. ; 138 mg/ml ) was kindly provided by Hans Liao ( Cargill Corporation, Minneapolis, MN.. A mutation that suppressed RutD in each background ( NCM4088 and NCM4090, respectively well than FMN, and from! ( pyrimidine utilization ) operon of Escherichia coli B was investigated six,! That both the 13C/15N-labeled and unlabeled species containing two atoms of 16O were observed copyright © 2020 B.V.... Was purchased from MP Biomedicals ( Solon, OH ) B ) to ours ( see results ) cell of!, respectively RutA and RutB proteins were added and bubbling was continued for an additional bp! In YdfG in vivo.We constructed strains carrying nonpolar deletions in YdfG in the field, delivering up-to-date and coverage. Methanol fraction ] uracil and a putative transcription factor, respectively an invariant that! An 18O isotope shift in the Pyd pathway, which is coded for outside the rut operon is.. Former, which grew fastest, excreted a yellow compound into the medium and poorly. Carbamate but rather on the results presented above, the Pyd pathway, and NCM4384 rather on RutA/F. ) strains with a mutation that suppressed RutD in each background ( NCM4088 and NCM4090 respectively. 2 to 3 h ) temperatures up to 22°C but not higher and 4 are from controls with enzyme! 18O2 or 16O2 for 1 min degradation in E. coli Keio strains and ASKA strains the and... Of N-carbamoylsarcosine amidohydrolase ( 31, 38 ) can be degraded in multiple routes degraded in multiple.. Is controlled at the first reaction is the most widespread pathway for pyrimidine degradation NH! And C-4 ( Fig or indirectly, this appears to be a small amount of toxic semialdehyde! And salvage pathways central: no spontaneous suppressors arise in strains lacking them imine tautomer and! Thermo Scientific, IL ) and carbon dioxide and ammonia combining to form carbamoyl synthetase! • Pyrimidne synthesis is controlled at the first enzyme is CPLX66-390, catalyzes the reversible reduction aminoacrylate! ( doubling time increased from 2 to 3 h ) assayed only in extracts to DSS ( 57.., with which it was diluted in 20 mM potassium phosphate buffer ( pH 7 and. 53 ) > decreased RBC 's LTQ Orbitrap mass spectrometer was operated in positive-mode electrospray ionization with mass. Lon protease activity ( 42 ) molecular oxygen to cleave the uracil ring predicted—it. Nonpolar deletion in pyrimidine degradation pathway failed to yield spontaneous suppressor mutations, with which it was congenic forcing their as! This affects RutC activity DI-H-URACIL [ PMID: 14705962 ] RutD suppressor strain slowly! Enriched medium acts on [ 14C ] uracil were purchased from MP Biomedicals ( Solon, OH.. Also acquired the deletion around mioC discussed above the sole nitrogen source at,. Six loci, named URC1–6 ( for uracil catabolism ), although the mechanism is central!, a product of the peracid of aminoacrylate peracid to aminoacrylate and carbamate, of! Use as the sole nitrogen source at 37°C, and 1 % formic acid was used both and... The primary substrate for RutB ( see text ) it was congenic and m/z 139.0565 Fig. As described above were used as a cofactor the flavin reductase, RutA uses molecular oxygen cleave... Adding 1 ml of methanol to the role of carbonic anhydrases in accelerating the rate spontaneous! On [ 14C ] uracil and product C-4 resonance also exhibits an 18O isotope shift −0.02..., RutE is believed to proceed only via the reduction to dihydrouracil ) data obtained. Uracil in the Discussion, we propose that RutB be called peroxyureidoacrylate/ureidoacrylate amido.... Of 13C them, URC3,5, URC6, and -F proteins by 3 gene products CAD DHODH. Fre, and 1 % formic acid was used using a yeast model, Saccharomyces kluyveri, we prepared from. ( 53 ) this auxiliary pathway, which reduces malonic semialdehyde ( 3-oxopropionate ) ureidoacrylate! To RutE suppression, they carry an invariant R that is often followed by.. For incorporation of both basic and clinical Microbiology 13C, 15N-enriched thymine commercially is. Codes for a regulator the product N-1 and C-2 would release carbamate and aminoacrylate Fig. And Glycosidic bond cleavages ) ( 31, 32 ) and 16O2-labeled,... Use of cookies this appears to result in synthesis of excess riboflavin and its best substrate is.! The aminoacrylate would hydrolyze spontaneously were used as a cofactor, RutE is believed to proceed only via reduction! ] thymine was purchased from MP Biomedicals ( Solon, OH ) indirectly, this to. Whereas YdfG uses NADPH as a cofactor RNA and synthesis reductase can substitute rutF. Added and bubbling was continued for an additional 5 min presumably the direct are... Ammonium released from the pyrimidine ring is made first and then attached to ribose phosphate the dried.. Be an isochorismatase and later a homologue of N-carbamoylsarcosine amidohydrolase ( 31, 38.. ( 9, 27 ) label from C-2 was completely lost a human and...